- Research
- Open access
- Published:
RHOF promotes Snail1 lactylation by enhancing PKM2-mediated glycolysis to induce pancreatic cancer cell endothelial–mesenchymal transition
Cancer & Metabolism volume 12, Article number: 32 (2024)
Abstract
Background
The influence of the small Rho GTPase Rif (RHOF) on tumor growth, glycolysis, endothelial–mesenchymal transition (EMT), and the potential mechanism of RHOF in pancreatic cancer (PC) were explored.
Methods
RHOF expression in PC tissues and cells was assessed by qRT-PCR and western blotting. The viability, proliferation, apoptosis, migration, and invasion of PC cells were assessed using CCK-8, colony formation, EdU, flow cytometry, scratch, and Transwell assays. The expression of EMT- and glycolysis-related proteins was determined using western blotting. The potential mechanisms of action of RHOF in PC were identified using bioinformatic analysis. The effects of RHOF were assessed in vivo using a xenograft mouse model.
Results
PC cell proliferation, migration, and invasion are accelerated by RHOF overexpression, which inhibited apoptosis. RHOF overexpression promoted EMT and glycolysis as evidenced by a decrease in E-cadherin expression and an increase in N-cadherin, Vimentin, HK2, PKM2, and LDHA expression. Bioinformatic analysis indicated that RHOF activated EMT, glycolysis, and Myc targets and that c-Myc could bind to the PKM2 promoter. RHOF overexpression promotes the lactylation and nuclear translocation of Snail1. Silencing Snail1 reversed the promoting effects of RHOF and lactate on cell migration, invasion, and EMT. Moreover, in vivo tumor growth and EMT were inhibited by RHOF silencing.
Conclusion
RHOF plays an oncogenic role in PC. c-Myc is upregulated by RHOF and promotes PKM2 transcription. PKM2 further induces glycolysis, and the lactate produced by glycolysis causes the lactylation of Snail1, ultimately promoting EMT.
Background
As a common exocrine cell tumor of the pancreas, pancreatic ductal adenocarcinoma is the seventh leading cause of death among patients with cancer worldwide. [1, 2] For patients with pancreatic ductal adenocarcinoma, the 5-year disease-free survival rate has been consistently less than 10% for decades [3, 4]. Although the survival rate of patients with pancreatic cancer (PC) has increased owing to the development of diagnosis, systematic treatments, and radiotherapy techniques, the number of patients with PC and PC-related deaths has increased steadily. [1, 5] There are many risk factors for PC, including metabolic syndrome, pancreatic cysts, chronic pancreatitis, smoking susceptibility gene mutations, alcohol abus [6,7,8]. Approximately 80% of patients with PC suffer from advanced diseases or distant metastases, and no effective treatment option exists. [9] Unfortunately, the mechanisms of invasion and metastasis remain unclear. Therefore, a better understanding of the mechanisms underlying PC is urgently required to develop better therapeutic strategies.
Eight subfamilies (RhoH, RhoU, RhoBTB, RhoD, Rnd, Cdc42, Rac, and RhoA) belong to the Rho GTPase family [10, 11]. Among members of the Rho GTPase family, Cdc42, Rac, and RhoA are intensively studied, including PC [12,13,14,15]. Small Rho GTPase Rif (RHOF), a member of the RhoD subfamily, is expressed in immune tissues, hematopoietic cells and neuronal cells, and facilitates the development of murine B cells [16]. RhoF is the main regulatory factor for membrane trafficking and regulates intracellular transport in vesicular cells [17]. Moreover, RHOF levels were elevated in lymphomas [18]. In PC, RHOF is highly expressed and regulates the endothelial–mesenchymal transition (EMT). [19] However, the functional mechanism of the RHOF in PC remains unclear and requires further investigation.
In recent years, some studies have indicated that reprogrammed metabolism is associated with the carcinogenesis, progression, and prognosis of PC [20, 21]. In PC cells, glycolysis is a typical reprogrammed metabolism, which is characterized by an increase in glucose uptake and lactate production [22]. Glycolysis can generate energy to promote the proliferation and anabolic growth of cancer cells [23]. Glycolysis causes lactate accumulation in the tumor microenvironment, thereby promoting tumor cell metastasis [24, 25]. In addition, important intermediates and enzymes of glycolysis have a hand in angiogenesis and EMT in PC cells [26, 27].
In this study, we performed in vivo and in vitro experiments to evaluate RHOF expression in PC and assessed its influence on glycolysis and EMT. In addition, the potential mechanism of action of the RHOF in PC was explored. Our findings suggest novel targets and therapeutic strategies for PC treatment.
Methods
Bioinformatic analysis
In PC, RHOF expression was analyzed using The Cancer Genome Atlas (TCGA) database (https://portal.gdc.cancer.gov/). The overall survival (OS) of patients with PC was analyzed using Gene Expression Profiling Interactive Analysis (GEPIA, http://gepia.cancer-pku.cn/). Kaplan–Meier analysis and the log-rank test were used to determine the difference in OS between the RHOF high-expression (n = 89) and the RHOF low-expression groups (n = 89). Pearson’s test was used to analyze the correlation between the expression of RHOF and PKM in PC tissues according to TCGA database. Based on TCGA database, the enriched pathways activated and inhibited by RHOF were analyzed using Gene Set Enrichment Analysis (GSEA). Target binding between c-Myc and PKM2 promoters was predicted using MOTIF software.
Human specimens
This study was approved by the Ethics Committee of our hospital. Thirty patients who underwent pancreatic resection between February 2022 and February 2023 had PC with normal adjacent tissues. Inclusion criteria: (1) The patients had no other primary malignant tumors; (2) before surgery, patients did not receive any treatment such as radiotherapy and chemotherapy; (3) all patients were confirmed as PC using histopathology. The exclusion criteria: (1) the patients with other major illnesses, such as heart and kidney diseases and; (2) patients who were unwilling to participate in the study. Informed consent was obtained from all patients.
Cell culture
Human pancreatic ductal adenocarcinoma epithelial cell lines (CFPAC-1, HPAF-II, PaCa-2, and PANC-1) were purchased from ProCell (Wuhan, China). The American Type Culture Collection (ATCC) provided the human pancreatic adenocarcinoma epithelial cell line SW1990. CFPAC-1 cells were cultured in Iscove’s Modified Dulbecco Medium (ProCell) containing 1% penicillin–streptomycin (P/S) solution (Gibco, USA) and 10% fetal bovine serum (FBS, Gibco). HPAF-II cells were cultured in Minimum Essential Medium supplemented with 1% P/S solution and 10% FBS. In Dulbecco's Modified Eagle Medium (DMEM; ProCell) containing 1% P/S solution and 10% FBS, PaCa-2, SW1990, and PANC-1 cells were cultured. All cells were incubated at 37 °C under a humidified atmosphere with 5% CO2.
Cell transfection
siNC (5′-ACGUGACACGUUCGGAGAATT-3′), siRHOF-1 (5′-GCTACGACAACGTCCTCATCA-3′), siRHOF-2 (5′-GCGGCTAGACTCTTGGAACAT-3′), empty vector, RHOF overexpression vector, si1-c-Myc (5′-CACCTATGAACTTGTTTCA-3′), si2-c-Myc (5′-GCCGTATTTCTACTGCGAC-3′), c-Myc overexpression vector, PKM2 overexpression vector, siPKM2 (5′-GGAACACTGGCATCATCTGTA-3′), siSNAIL1 (5′-GACCCACTCAGATGTCAAGAA-3′) were constructed by RiboBio (Guangzhou, China). Lipofectamine 2000 (Invitrogen) was used for transfection according to the manufacturer’s instructions. Transfection efficiency was assessed using western blotting and quantitative real-time polymerase chain reaction (qRT-PCR).
qRT-PCR
Total RNA was extracted from the cells and tissues using TRIzol Reagent (Invitrogen). The PrimeScript RT Reagent Kit (TaKaRa, Japan) was used for reverse transcription into complementary DNA. A SYBR Green PCR Kit (Qiagen, Germany) was used for qRT-PCR on a LightCycler 480 II (Roche, Switzerland). Tsingke Biotech provided primers [RHOF, forward (F): 5′-GGAAGGAGCTGAAGATCGTG-3′, reverse (R): 5′-CCTCAGGGAACCACTTGATGA-3′; PKM2, F: 5′- CTGTGCTACTCAGATGCTGGA -3′, R: 5′-TGCAAGTGGTAGATGGCAGC-3′; GAPDH (internal control), F: 5′- GACAGTCAGCCGCATCTTCT-3′, R: 5′-CCCGTTCTCAGCCATGTAGT-3′; E-cadherin, forward (F): 5′-GGGGTCTGTCATGGAAGGTG-3′, reverse (R): 5′-CAAAATCCAAGCCCGTGGTG-3′; N-cadherin, forward (F): 5′-GGCGTTATGTGTGTATCTTCACTG-3′, reverse (R): 5′-ACTTCTGCTGACTCCTTCACTG-3′; Vimentin, forward (F): 5′-CCTCCGGGAGAAATTGCAGG-3′, reverse (R): 5′-CGTTCAAGGTCAAGACGTGC-3′]. According to the 2−ΔΔCt method, the expression levels of mRNA were counted.
Western blot
Radioimmunoprecipitation assay buffer (Sigma-Aldrich, USA) was used to extract total protein from the cells and tissues. Subsequently, proteins (40 µg) were separated using SDS-PAGE, and then transferred to PVDF membranes (Millipore, USA). The membranes were blocked with 5% non-fat milk, incubated with anti-RHOF (ab101349, Abcam, USA), anti-GAPDH (60004–1-Ig, Proteintech), anti-E-cadherin (20874–1-AP, Proteintech), anti-N-cadherin (22018–1-AP, Proteintech), anti-Vimentin (10366–1-AP, Proteintech), anti-HK2 (ab227198, Abcam), anti-PKM2 (ab137791, Abcam), anti-LDHA (ab52488, Abcam), anti-Snail1 (13099–1-AP, Proteintech), and anti-c-Myc, (10828–1-AP, Proteintech) at 4 °C overnight, and then incubated with secondary antibodies (Santa Cruz Biotechnology) for 2 h at room temperature. ECL reagent (Nanjing KeyGEN Biotech Co., Ltd., Nanjing, China) was used to visualize the protein bands.
Cell Counting kit-8 (CCK-8) assay
PANC-1, SW1990, and HPAF-II cells (5 × 103 cells/well) were seeded in 96-well plates, and then treated with 10 µL CCK-8 solution (Nanjing KeyGen Biotech Co., Ltd.). After incubation at 37 °C for 2 h, at 450 nm, the optical density (OD) value was measured using a spectrophotometer (BioTek Instruments, USA).
Cell colony formation
After transfection, PANC-1, SW1990, and HPAF-II cells (1 × 103 cells/well) were seeded into 6-well plates. After incubation at 37 °C for 10 days, the cells were immobilized in methanol (Sigma-Aldrich). Stained cells were treated with crystal violet (Sigma-Aldrich). Colony formation was assessed using a microscope.
5-Ethynyl-2’-deoxyuridine assay
After transfection, PANC-1, SW1990, and HPAF-II cells (1 × 105 cells/well) were seeded into 24-well plates. After incubation with 50 μM 5-Ethynyl-2′-deoxyuridine (EdU; RiboBio) for 2 h, cells were fixed in 4% polyformaldehyde (Sigma-Aldrich), incubated with 0.3% Triton X-100, and then incubated with DAPI. Finally, EdU-positive cells were observed under a microscope.
Flow cytometry
After transfection, SW1990, HPAF-II, and PANC-1 cells were re-suspended in 1 × binding buffer. Subsequently, cells were treated with 5 μL FITC Annexin V for 15 min and 5 μL PI (Dojindo, Japan) for 10 min. Finally, flow cytometry (BD Biosciences, USA) was taken to analyze apoptotic cells.
Cell scratch assay
After transfection, PANC-1, SW1990, and HPAF-II cells (2 × 105 cells/well) were seeded in 6-well plates. Until culturing to approximately 100% confluence, the cell monolayer was scratched using a 10 μL pipette tip. Images were captured at 0 and 24 h after scratching. Finally, the wound closure rate was calculated.
Transwell assay
For invasion assay, after transfection, SW1990, HPAF-II, and PANC-1 cells in serum-free medium (100 µL) were seeded to the upper chamber of a Transwell systerm (Corning, USA) coated with Matrigel. The lower chamber contained 600 µL medium with 10% FBS. After culturing for 24 h, invasive cells were fixed with methanol. After staining with 0.1% crystal violet, invasive cells were counted under a microscope.
For the migration assay, Transwell chambers were coated without Matrigel. Other experimental steps were performed as described previously for the invasion assay.
Measurement of oxygen consumption rate and extracellular acidification rate
Cellular respiration and glycolytic activity were determined by measuring oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) using an XF96 Extracellular Flux Analyzer (Seahorse Bioscience, USA) as previously described [28, 29]. In XF96 cell culture microplates, SW1990, HPAF-II, and PANC-1 cells (1.5 × 104 cells/well) were cultured for 24 h. OCR was detected with a Seahorse assay medium containing 1 μM oligomycin, 1 μM carbonyl cyanide-4-phenylhydrazone (FCCP), and 1 μM rotenone/1 μM antimycin A. ECAR was detected with an XF base medium containing 10 mM glucose, 1 mM oligomycin, and 50 mM 2-DG.
Measurement of lactate production and glucose uptake
Lactate production and glucose uptake were tested using lactate assay kits II (MAK065, Sigma-Aldrich) and Glucose Uptake Colorimetric Assay Kit (K676-100, Biovision, USA), respectively, according to the manufacturer’s instructions.
Luciferase assay
In HEK293T cells, the pGL3-PKM2 promoter plasmid or the pGL3-PKM2 promoter mut-type (Mut) plasmid was co-transfected with the pGL3pcDNA3.1-c-Myc plasmid using Lipofectamine 2000. Forty-eight hours after transfection, a Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) was used to determine luciferase activity.
Chromatin immunoprecipitation assay
The SimpleChIP® Enzymatic Chromatin IP Kit (CST) was used to perform ChIP assay. HPAF-II and PANC-1 cells were incubated with 1% formaldehyde at room temperature for 10 min to cross-link the proteins. A color change in the medium was resulted by adding 2 mL of 10 × glycine. After removing the media, washing with ice-cold PBS, centrifugating at 3,000 rpm for 5 min at 4 °C, DNA in cells was sonicated to 200–300 bp fragments. Next, the fragments were immunoprecipitated with antibody [anti-IgG (ab172730, Abcam) or anti-c-Myc (ab32072, Abcam)] at 4 °C overnight and the complex co-precipitates and is captured by Protein G Agarose or Protein G magnetic beads. Cross-links were revealed, DNA was purified, and qRT-PCR was performed to analyze the precipitated chromatin DNA.
Immunofluorescence staining
In 4% paraformaldehyde, HPAF-II and PANC-1 cells were fixed at 4 °C. After 30 min, cells were treated with 0.1% Triton X and blocked with 5% BSA. Next, anti-Snail1 (H00006615-M10, Abnova) and anti-Kla (PTM-1401RM, PTM Biolabs) antibodies were used to incubate cells at 4 °C overnight, and then cells were incubated with goat anti-mouse IgG H&L (Alexa Fluor® 488) (ab150113, Abcam) and goat anti-rabbit (Alexa Fluor® 555) (ab150078, Abcam) secondary antibodies for 1 h. Finally, cells were stained with DAPI.
For tissue immunofluorescence staining, tumor tissues were fixed in 4% paraformaldehyde, embedded in paraffin, rehydrated and antigen repaired. The sections were blocked with 5% BSA at 37℃ for 2 h, and incubated with a primary anti-CD31 antibody (ab9498, Abcam) at 4 °C overnight. After incubation with a goat anti-mouse IgG H&L (Alexa Fluor® 488) (ab150113, Abcam) for 1 h, the nuclei were stained with DAPI for 10 min. For immunofluorescence co-localization detection of Kla and Snail1, sections were incubated with primary anti-Snail1 (H00006615-M10, Abnova) and anti-Kla (PTM-1401RM, PTM Biolabs) antibodies followed by goat anti-mouse IgG H&L (Alexa Fluor® 647) (ab150119, Abcam) and goat anti-rabbit (Alexa Fluor® 488) (ab150077, Abcam) secondary antibodies. Images were captured using a fluorescence microscope (Olympus).
Immunoprecipitation
Lysates of HPAF-II and PANC-1 cells were incubated with antibody [anti-Snail1 (ab216347, Abcam) and anti-pan-Kla (PTM-1401, PTM Biolabs)] overnight at 4 °C and then added protein A/G beads (Santa Cruz Biotechnology). After incubation for 2 h, the beads were centrifuged for 2 min at 2000 × g. The dried beads were placed in 1 × loading buffer. After boiling for 5 min, western blotting was performed.
Xenograft mice models
All animal experiments were approved by the Animal Ethics Committee of our hospital. PANC-1 cells (1 × 107) transfected with shRHOF or shNC were inoculated into the right side of the anterior flank of BALB/c nude mice (five in each group, 5-week-old; GemPharmatech Co., Ltd., China). From the tenth day after inoculation, the tumor volume was measured every 3 days. After inoculation for 31 days, the mice were sacrificed. Tumor tissues were subjected to western blotting, terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) and immunohistochemical (IHC) analysis. The xenograft tumors were weighed.
IHC
Tissues were stored in 4% paraformaldehyde (Sigma-Aldrich). After embedding in paraffin, tissues were sliced into 4 μm thick sections. Next, the sections were deparaffinized and boiled in a sodium citrate antigen retrieval solution (Beyotime Biotechnology). After blocking in 3% bovine serum albumin (Sigma-Aldrich), sections were incubated overnight with anti-RHOF (HPA076019, Sigma-Aldrich), aiti-Ki67 (34330, CST)] at 4 °C, then secondary antibody was applied to incubate sections at room temperature for 30 min. Finally,, the sections were stained with 3,3′-diaminobenzidine (DAB; Beyotime Biotechnology) and hematoxylin (Beyotime Biotechnology). Under a microscope (Nikon Eclipse, Japan). The IHC images were captured using a microscope (Nikon Eclipse). The IHC score ranged from 0 ~ 12 was calculated as previously reported [30].
TUNEL staining
The In Situ Cell Death Detection Kit (Roche, USA) used for the TUNEL assay. After deparaffinization in xylene, rehydration with graded alcohol, and permeabilization through 0.1% Triton X-100, tissues sections were treated by 50 μL TUNEL reaction mixture for 1 h. After washing with phosphate-buffered saline (PBS), the sections were stained with DAPI. The TUNEL-positive cells were counted using a fluorescence microscope.
Statistical analysis
The data were analyzed using SPSS and GraphPad Prism software, and showed as the mean ± SD. For comparisons among groups, the Student’s t-test and one-way ANOVA were used. P value less than 0.05 were considered significant.
Results
For patients with PC, high expression of RHOF is correlated with poor survival
To examine the influence of RHOF on PC, changes in RHOF in pancreatic adenocarcinoma (PAAD) were first assessed according to TCGA database. Compared to normal tissues, RHOF was overexpressed in PAAD tissues (Fig. 1A). Based on TCGA database, Kaplan–Meier analysis indicated that poor OS was observed in patients with higher expression of RHOF (Fig. 1B). Furthermore, RHOF expression was detected in PC tissues and their corresponding adjacent tissues using qRT-PCR, which showed that RHOF expression in PC tissues was higher than that in adjacent non-tumor tissues (Fig. 1C). More importantly, the increased expression of RHOF in PC tissues was validated using IHC and western blotting (Fig. 1D and E). In addition, RHOF expression in PC cell lines was tested, which showed that RHOF was expressed higher in PANC-1 and SW1990 cells but lower in HPAF-II cells (Fig. 1F). In the following experiments, PANC-1 and SW1990 cells were selected for knockdown experiments, HPAF-II cells were chosen for overexpression experiments.
In patients with PC, high expression of RHOF is correlated with poor survival. A RHOF expression in PAAD tissues (n = 179) and normal tissues (n = 171) was assessed according to TCGA database. B Kaplan–Meier was performed to analyze OS in patients with low (n = 89) and high (n = 89) expression of RHOF. RHOF expression was detected in PAAD tissues and their corresponding adjacent tissues using qRT-PCR (n = 30) (C), IHC (n = 10) (D), and western blotting (n = 10) (E). F In PAAD cell lines (CFPAC-1, HPAF-II, PaCa-2, PANC-1, and SW1990), RHOF expression was tested using western blotting (n = 3). Data in (A) were analyzed using the unpaired t‑test. Data in other figures were analyzed using the paired t-test
RHOF accelerates PC cell growth while inhibiting apoptosis
Figure 2A and B showed that RHOF was successfully knocked down in PANC-1 and SW1990 cells and overexpressed in HPAF-II cells. Next, a functional analysis of the RHOF was performed. Figure 2C shows that RHOF knockdown reduced the viability of PANC-1 and SW1990 cells, whereas RHOF overexpression increased the viability of HPAF-II cells. Cell proliferation was inhibited by RHOF knockdown, whereas RHOF overexpression promoted cell proliferation (Fig. 2D and E). Additionally, RHOF knockdown promoted apoptosis, whereas RHOF overexpression inhibited it (Fig. 2F).
RHOF accelerates PC cell growth while inhibiting apoptosis. A RHOF mRNA expression was tested using qRT-PCR. B Western blot was taken to test RHOF protein expression. C Cell viability was checked via CCK-8 assay. D and E Cell proliferation was assessed through EdU and colony formation assays. F Cell apoptosis was measured by means of flow cytometry. n = 3. Data in (C) were analyzed using two‑way ANOVA. Data in other figures were analyzed using the one‑way ANOVA (three group comparisons) or paired t-test (two group comparisons)
RHOF promotes PC cell migration, invasion, and EMT
The scratch experimental data suggested that RHOF knockdown inhibited cell migration, whereas RHOF overexpression promoted cell migration (Fig. 3A). Transwell assays demonstrated that cell migration and invasion were inhibited by RHOF knockdown; however, RHOF overexpression had the opposite effect (Fig. 3B). Interestingly, knockdown of RHOF increased E-cadherin expression, whereas it downregulated the expression of N-cadherin and Vimentin (Fig. 3C and D). In contrast, overexpression of RHOF downregulated E-cadherin expression and increased the expression of N-cadherin and Vimentin.
PC cell migration, invasion, and EMT were promoted by RHOF. A Scratch experiment was utilized to estimate cell migration. B Cell migration and invasion were estimated through Transwell assay (Magnification × 100). C qRT-PCR and (D) western blot was utilized to estimate the expression of E-cadherin, Vimentin, and N-cadherin. n = 3. Data were analyzed using the one‑way ANOVA (three group comparisons) or paired t-test (two group comparisons)
RHOF promotes PC cell glycolysis
Based on TCGA database, we conducted a correlation analysis. A positive correlation was observed between RHOFs and PKM expression (Fig. 4A). Next, we checked for changes in ECAR and OCR. Figure 4B and 4C show that RHOF knockdown decreased ECAR and increased OCR, whereas RHOF overexpression increased ECAR and decreased OCR. Moreover, glucose uptake and lactate production was reduced by RHOF knockdown, whereas RHOF overexpression increased glucose uptake and lactate production (Fig. 4D and E). RHOF knockdown downregulated the expression of the glycolytic markers (HK2, PKM2, and LDHA), whereas RHOF overexpression promoted the expression of these proteins (Fig. 4F).
RHOF promotes PC cell glycolysis. A Based on TCGA database, between the expression of RHOF and PKM, a positive correlation was found. B and C The levels of ECAR and OCR were detected using the metabolic analyzer. D Glucose uptake in PANC-1, SW1990, and HPAF-II cells. E Lactate production in PANC-1, SW1990, and HPAF-II cells. F Western blot was utilized to estimate the protein expression of HK2, PKM2, and LDHA. n = 3. Data were analyzed using the one‑way ANOVA (three group comparisons) or paired t-test (two group comparisons)
GSEA analysis indicates RHOF activates EMT, glycolysis, and Myc targets
GSEA results showed that RHOF had a positive regulatory relationship with Myc targets, EMT, and glycolysis (Fig. 5A and B). As c-Myc is a well-known transcription factor, we suspected that RHOF may affect gene transcription and translation by regulating c-Myc, thereby affecting EMT and glycolysis in PC. Western blotting analysis showed that RHOF knockdown inhibited c-Myc expression, whereas RHOF overexpression promoted c-Myc expression (Fig. 5C). Moreover, MOTIF software predicted the target binding sequence between the c-Myc and PKM2 promoters, and the target binding between c-Myc and the PKM2 promoter was validated (Fig. 5D). qRT-PCR and western blotting showed that PKM2 expression was inhibited by silencing c-Myc, whereas c-Myc overexpression promoted PKM2 expression (Fig. 5E and F). Furthermore, the anti-c-Myc antibody increased the enrichment of the PKM2 promoter in PANC-1 and HPAF-II cells (Fig. 5G). In summary, RHOF promotes PKM2 expression by upregulating c-Myc expression.
GSEA analysis indicates RHOF activates EMT, glycolysis, and c-Myc targets. A and B GSEA showed that RHOF had a positive regulatory relationship on Myc targets, EMT, and glycolysis. C Western blot was done to test c-Myc expression. D MOTIF software predicted the target binding sequence between c-Myc and PKM2 promoters, and luciferase reporter gene experiments validated their binding. E PKM2 mRNA expression was tested using qRT-PCR. F Western blot was taken to test PKM2 protein expression. G ChIP assay confirmed the binding of c-Myc and PKM2 promoter. n = 3. Data were analyzed using the one‑way ANOVA (three group comparisons) or paired t-test (two group comparisons)
RHOF promotes PC cell glycolysis via c-Myc-induced PKM2 transcription
To test this hypothesis, we performed rescue experiments using PANC-1 and HPAF-II cells. ECAR decreased and OCR increased following RHOF knockdown in PANC-1 cells, whereas PKM2 overexpression reversed the effect of RHOF knockdown on ECAR and OCR (Fig. 6A and B). In HPAF-II cells, RHOF overexpression increased ECAR and decreased OCR, while silencing PKM2 reversed the effects of RHOF overexpression on ECAR and OCR (Fig. 6A and B). Furthermore, in PANC-1 cells, glucose uptake and lactate production was reduced by RHOF knockdown, while overexpression of PKM2 reversed the regulatory effect of RHOF knockdown on glucose uptake and lactate production (Fig. 6C). RHOF overexpression increased glucose uptake and lactate production in HPAF-II cells, while silencing PKM2 reduced glucose uptake and lactate production (Fig. 6C). Taken together, we speculate that RHOF promotes PKM2 transcription by upregulating c-Myc expression, which induces glycolysis. However, the relationship between glycolysis and EMT remained unclear (Fig. 6D).
RHOF promotes PC cell glycolysis via c-Myc-induced PKM2 transcription. A and B The levels of ECAR and OCR were detected using the metabolic analyzer. C Glucose uptake and lactate production in PANC-1 and HPAF-II cells. D The mechanism diagram of RHOF in regulating PC cell glycolysis. n = 3. Data were analyzed using the one‑way ANOVA
RHOF promotes EMT via inducing glycolysis and Snail1 lactylation in PC cell
A previous study reported that lactate promotes EMT by inducing the lactylation of Snail1 [31]. Here, we studied whether the lactate caused by RHOF overexpression could cause the Lactylation of Snail1 to promote EMT. The results of IP experiment showed that RHOF knockdown inhibited Snail1 lactylation, whereas RHOF overexpression promoted Snail1 lactylation (Fig. 7A). The results of wetsern blotting showed that RHOF knockdown did not significantly affect Snail1 expression in the cytoplasm, but inhibited Snail1 expression in the nucleus, whereas RHOF overexpression did not affect Snail1 expression in the cytoplasm but promoted its expression in the nucleus (Fig. 7B). Importantly, RHOF knockdown inhibited the co-localization of Kla and Snail1 in the nucleus, whereas RHOF overexpression promoted the nuclear co-localization of Kla and Snail1 (Fig. 7C). Next, we conducted rescue experiments in HPAF-II cells using the glycolysis inhibitor, 2-DG. As shown in Fig. 7D, RHOF overexpression promoted Snail1 lactylation, whereas 2-DG reversed the effect of RHOF on Snail1 lactylation. Figure 7E and F suggested that RHOF overexpression promoted the nuclear co-localization of Kla and Snail1, while 2-DG inhibited the nuclear co-localization of Kla and Snail1 compared to the RHOF group.
RHOF promotes EMT via inducing glycolysis and Snail1 lactylation in PC cell. A IP assay was applied to identify the interaction between Snail1 and Pan-Kla. B Western blot was taken to test Snail1 expression. C Immunofluorescence co-localization detection of Kla and Snail1. D IP assay was applied to detect the interaction between Snail1 and Pan-Kla under 2-DG treatment. E Western blot was taken to test Snail1 expression under 2-DG treatment. F Immunofluorescence co-localization detection of Kla and Snail1 under 2-DG treatment. G Scratch experiment was utilized to estimate cell migration. H Cell migation and invasion were estimate by Transwell assay (Magnification × 100). I Western blot was utilized to estimate the protein expression of E-cadherin, Vimentin, and N-cadherin. J The mechanism diagram of RHOF in regulating PC cell glycolysis and EMT. n = 3. Data were analyzed using the one‑way ANOVA (three group comparisons) or paired t-test (two group comparisons)
As indicated in Fig. 7G and 7H, in HPAF-II cells, lactate promoted cell migration and invasion, while silencing Snail1 inhibited the effects of lactate. Silencin of Snail1 also inhibited the effects of RHOF on cell migration and invasion. Western blotting showed that E-cadherin expression was reduced and the expression of N-cadherin and Vimentin was increased by lactate, whereas silencing of Snail1 increased E-cadherin expression and decreased N-cadherin and Vimentin expression compared to the Lactate + siNC group (Fig. 7I). Silencing Snail1 also inhibited the promoting effect of RHOF on the expression of EMT-related proteins (Fig. 7I). Finally, we drew the mechanism diagram of this study: RHOF promoted the expression of c-Myc, caused the transcriptional activation of PKM2, and induced glycolysis. Lactate produced by glycolysis causes Snail1 lactylation, ultimately promoting EMT in PC cells (Fig. 7J).
Silencing of RHOF inhibits PC tumor growth and EMT in xenograft mouse models
To confirm the effects of RHOF in vivo, we constructed a PC xenograft model. As shown in Fig. 8A-C, compared to the shNC group, silencing of RHOF reduced tumor volume and weight. Figure 8D-8F showed that silencing RHOF reduced the number of Ki67-positive cells and increased the proportion of apoptotic cells. Silencing of RHOF reduced CD31 positive cells, indicating the potential of RHOF in regulating blood vessel formation. In addition, silencing of RHOF inhibited the co-localization of Kla and Snail1 in PC xenograft model (Fig. 8G). Western blotting results showed that, the shRHOF group had lower levels of N-cadherin, Vimentin, c-Myc, PKM2, and Snail1, and higher levels of E-cadherin than the shNC group (Fig. 8H and I).
Silencing of RHOF inhibits PC tumor growth and EMT in xenograft mouse models. A Image of xenograft tumor. B The volume of xenograft tumor. C The weight of xenograft tumor. D Representative images of TUNEL assays and IHC for detecting Ki67 and CD31 positive cells. E Ki67-positive cells in tumor tissues. F TUNEL-positive cells in tumor tissues. G Immunofluorescence co-localization detection of Kla and Snail1. H Western blot was utilized to estimate the protein expression of c-Myc, PKM2, and Snail1. I The protein expression of E-cadherin, Vimentin, and N-cadherin was estimated using Western blot. n = 5. Data were analyzed using paired t-test
Discussion
Among common tumors, PC has a poor prognosis owing to its advanced diagnosis, aggressive phenotype, and resistance to systemic therapy, posing a great threat to human beings [32]. For the improvement in treatments, it is necessary to better understanding the molecular mechanisms of PC. In this study, RHOF was upregulated in PC tissues. Consistent with our findings, high RHOF expression has also been observed in acute myeloid leukemia, eosinophilic esophagitis, and hepatocellular carcinoma [33,34,35]. In addition, analysis of TCGA database showed that PC patients with advanced stage had higher RHOF expression, and high expression of RHOF was associated with poor prognosis. These findings indicated that RHOF play a significant role in PC progression.
A previous study indicated that the overexpression of RHOF enhanced PC cell viability and weakened the cytotoxic effect of gemcitabine on PC cells [19]. Here, we found that RHOF overexpression accelerated PC cell viability and proliferation, but inhibited cell apoptosis. RHOF knockdown inhibited PC cell viability and proliferation, while promoting apoptosis. Moreover, PC cell migration and invasion were promoted by RHOF overexpression, whereas RHOF knockdown had the opposite effects in the PC cells, EMT is a key step [36]. EMT can be activated by pathogenic stimuli, increasing cancer cell motility and facilitating tumor metastasis [37]. As a key epithelial marker, E-cadherin acts as a tumor suppressor and participates in cell migration, differentiation, and polarity [38]. During EMT in cancer cells, N-cadherin is upregulated, enhancing cancer cell migration [39]. As a marker of EMT, the upregulation of Vimentin is correlated with cell invasion and tumor growth [40]. In our study, RHOF overexpression downregulated E-cadherin expression and upregulated N-cadherin and Vimentin expression. In contrast, E-cadherin expression was increased and the expression of N-cadherin and Vimentin was downregulated by RHOF knockdown. Furthermore, knockdown of RHOF restrained xenograft tumor growth and EMT in vivo. Overall, these results indicated that cell migration, invasion, tumor growth and EMT in PC were inhibited by the knockdown of RHOF.
Change in cellular metabolism are typical in cancer cells. As a metabolic pathway, glycolysis produces ATP through oxygen-independent enzymatic reactions from glucose [41]. During glycolysis process, lactate is a ubiquitous intermediate. Accumulating evidence indicates that lactate is associated with multiple diseases, including tumor progression [42, 43]. In this work, RHOF knockdown decreased glucose uptake, lactate production, and ECAR and increased OCR, while RHOF overexpression caused the opposite results. Increased levels of transporters and enzymes associated with glucose uptake and lactate production result in increased glycolysis [44]. As a key enzyme in glycolysis, HK2 catalyzes the phosphorylation of glucose to produce glucose 6-phosphate and is involved in multiple human tumors [45,46,47]. PKM2 converts phosphoenolpyruvate to pyruvate and generates ATP, which promotes tumor cell proliferation and survival [48]. LDHA catalyzes the conversion of pyruvate to lactate and high LDHA expression is associated with poor outcomes in patients with cancer. [49, 50] Here, overexpression of RHOF promoted the expression of HK2, PKM2, and LDHA. However, the expression of these proteins was inhibited by the knockdown of RHOF in vitro and in vivo. Briefly, RHOF knockdown inhibited glycolysis in PC cells.
Mechanistically, GSEA showed that RHOF has a positive regulatory relationship with Myc targets, EMT, and glycolysis. As a well-known transcription factor, c-Myc promotes cell proliferation, invasion, and genomic instability and is involved in metabolic reprogramming [51]. At the present study, RHOF knockdown inhibited c-Myc expression, whereas RHOF overexpression promoted c-Myc expression. Additionally, target binding between c-Myc and the PKM2 promoter was predicted using MOTIF software and validated using luciferase reporter gene experiments. Furthermore, we investigated the effects of RHOF overexpression and knockdown on ECAR, OCR, glucose uptake, and lactate production, the effects of RHOF overexpression or RHOF knockdown was weaken by silencing PKM2 or PKM2 overexpression. Taken together, these results suggest that RHOF may upregulate c-Myc expression, promote PKM2 transcription, and promote cell glycolysis. EMT is regulated by certain EMT-TFs, including Snail1 [37]. After myocardial infarction, Fan et al. revealed that lactate promoted EMT through Snail1 lactylation [31]. Here, we found that RHOF knockdown inhibited Snail1 lactylation, whereas RHOF overexpression promoted Snail1 lactylation. Moreover, silencing Snail1 reversed the promoting effects of lactate and RHOF overexpression on cell migration, invasion, and EMT. In summary, RHOF promoted PC cell migration, invasion, and EMT, which are involved in c-Myc-PKM2-glycolysis-lactate-Snail1 lactylation.
Conclusion
RHOF expression is upregulated in PC tissues and cells. In PC, RHOF accelerates tumor growth and promotes cell migration, invasion, and EMT. c-Myc is upregulated by RHOF, followed promoting the transcription of PKM2 and induced cell glycolysis. Lactate produced by glycolysis results in the lactateation of Snail1, eventually facilitating EMT in PC cells. Our study reveals a new molecular mechanism for oncogenesis and a new target for PC treatment.
Data availability
No datasets were generated or analysed during the current study.
Abbreviations
- EMT:
-
Epithelium-mesenchymal transition
- OS:
-
Overall survival
- PC:
-
Pancreatic cancer
- PAAD:
-
Pancreatic adenocarcinoma
- RHOF:
-
Rho GTPase Rif
- TCGA:
-
The Cancer Genome Atlas
References
Mizrahi JD, Surana R, Valle JW, Shroff RT. Pancreatic cancer. Lancet. 2020;395(10242):2008–20.
Bear AS, Vonderheide RH, O’Hara MH. Challenges and Opportunities for Pancreatic Cancer Immunotherapy. Cancer Cell. 2020;38(6):788–802.
Kleeff J, Korc M, Apte M, La Vecchia C, Johnson CD, Biankin AV, Neale RE, Tempero M, Tuveson DA, Hruban RH, et al. Pancreatic cancer Nat Rev Dis Primers. 2016;2(16022):22.
Siegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin. 2019;69(1):7–34.
Grossberg AJ, Chu LC, Deig CR, Fishman EK, Hwang WL, Maitra A, Marks DL, Mehta A, Nabavizadeh N, Simeone DM, et al. Multidisciplinary standards of care and recent progress in pancreatic ductal adenocarcinoma. CA Cancer J Clin. 2020;70(5):375–403.
Rawla P, Sunkara T, Gaduputi V. Epidemiology of Pancreatic Cancer: Global Trends, Etiology and Risk Factors. World J Oncol. 2019;10(1):10–27.
Abe T, Blackford AL, Tamura K, Ford M, McCormick P, Chuidian M, Almario JA, Borges M, Lennon AM, Shin EJ, et al. Deleterious Germline Mutations Are a Risk Factor for Neoplastic Progression Among High-Risk Individuals Undergoing Pancreatic Surveillance. J Clin Oncol. 2019;37(13):1070–80.
Kromrey ML, Bülow R, Hübner J, Paperlein C, Lerch MM, Ittermann T, Völzke H, Mayerle J, Kühn JP. Prospective study on the incidence, prevalence and 5-year pancreatic-related mortality of pancreatic cysts in a population-based study. Gut. 2018;67(1):138–45.
Kuehn BM. Looking to Long-term Survivors for Improved Pancreatic Cancer Treatment: JAMA. 2020;324(22):2242–4. https://doiorg.publicaciones.saludcastillayleon.es/10.1001/jama.2020.21717.
Bustelo XR, Sauzeau V, Berenjeno IM. GTP-binding proteins of the Rho/Rac family: regulation, effectors and functions in vivo. BioEssays. 2007;29(4):356–70.
van Helden SF, Anthony EC, Dee R, Hordijk PL. Rho GTPase expression in human myeloid cells. PLoS ONE. 2012;7(8):16.
Stankiewicz TR, Linseman DA. Rho family GTPases: key players in neuronal development, neuronal survival, and neurodegeneration. Front Cell Neurosci. 2014;8:314.
Zhang X, Ren Z, Xu J, Chen Q, Ma J, Liu Z, Kou J, Zhao X, Lang R, He Q. MiR-1301–3p Inhibits Epithelial-Mesenchymal Transition via Targeting RhoA in Pancreatic Cancer. J Oncol. 2022;26:5514715.
Wang Y, Zheng Y, Chen Q, Dai Y, Li T. MicroRNA-139 inhibits pancreatic-cancer carcinogenesis by suppressing RalB via the Ral/RAC/PI3K pathway. Arch Biochem Biophys. 2021;704(108719):5.
Razidlo GL, Burton KM, McNiven MA. Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42. J Biol Chem. 2018;293(28):11143–53.
Kishimoto M, Matsuda T, Yanase S, Katsumi A, Suzuki N, Ikejiri M, Takagi A, Ikawa M, Kojima T, Kunishima S, et al. Rhof promotes murine marginal zone B cell development. Nagoya J Med Sci. 2014;76(3–4):293–305.
Gad AK, Aspenström P. Rif proteins take to the RhoD: Rho GTPases at the crossroads of actin dynamics and membrane trafficking. Cell Signal. 2010;22(2):183–9.
Gouw LG, Reading NS, Jenson SD, Lim MS, Elenitoba-Johnson KS. Expression of the Rho-family GTPase gene RHOF in lymphocyte subsets and malignant lymphomas. Br J Haematol. 2005;129(4):531–3.
Yang RM, Zhan M, Xu SW, Long MM, Yang LH, Chen W, Huang S, Liu Q, Zhou J, Zhu J, et al. miR-3656 expression enhances the chemosensitivity of pancreatic cancer to gemcitabine through modulation of the RHOF/EMT axis. Cell Death Dis. 2017;8(10):530.
Roe JS, Hwang CI, Somerville TDD, Milazzo JP, Lee EJ, Da Silva B, Maiorino L, Tiriac H, Young CM, Miyabayashi K, et al. Enhancer Reprogramming Promotes Pancreatic Cancer Metastasis. Cell. 2017;170(5):875–88.
Qin C, Yang G, Yang J, Ren B, Wang H, Chen G, Zhao F, You L, Wang W, Zhao Y. Metabolism of pancreatic cancer: paving the way to better anticancer strategies. Mol Cancer. 2020;19(1):020–01169.
Cao L, Wu J, Qu X, Sheng J, Cui M, Liu S, Huang X, Xiang Y, Li B, Zhang X, et al. Glycometabolic rearrangements–aerobic glycolysis in pancreatic cancer: causes, characteristics and clinical applications. J Exp Clin Cancer Res. 2020;39(1):020–01765.
Kim DJ, Vo MT, Choi SH, Lee JH, Jeong SY, Hong CH, Kim JS, Lee UH, Chung HM, Lee BJ, et al. Tristetraprolin-mediated hexokinase 2 expression regulation contributes to glycolysis in cancer cells. Mol Biol Cell. 2019;30(5):542–53.
Schwartz L, Seyfried T, Alfarouk KO, Da Veiga MJ, Fais S. Out of Warburg effect: An effective cancer treatment targeting the tumor specific metabolism and dysregulated pH. Semin Cancer Biol. 2017;43:134–8.
de la Cruz-López KG, Castro-Muñoz LJ, Reyes-Hernández DO, García-Carrancá A, Manzo-Merino J. Lactate in the regulation of tumor microenvironment and therapeutic approaches. Front Oncol. 2019;9:1143.
Azoitei N, Becher A, Steinestel K, Rouhi A, Diepold K, Genze F, Simmet T, Seufferlein T. PKM2 promotes tumor angiogenesis by regulating HIF-1α through NF-κB activation. Mol Cancer. 2016;15(3):015–0490.
Zhao H, Duan Q, Zhang Z, Li H, Wu H, Shen Q, Wang C, Yin T. Up-regulation of glycolysis promotes the stemness and EMT phenotypes in gemcitabine-resistant pancreatic cancer cells. J Cell Mol Med. 2017;21(9):2055–67.
Hu Q, Qin Y, Ji S, Shi X, Dai W, Fan G, Li S, Xu W, Liu W, Liu M, et al. MTAP Deficiency-Induced Metabolic Reprogramming Creates a Vulnerability to Cotargeting De Novo Purine Synthesis and Glycolysis in Pancreatic Cancer. Cancer Res. 2021;81(19):4964–80.
Audet-Walsh É, Yee T, McGuirk S, Vernier M, Ouellet C, St-Pierre J, Giguère V. Androgen-Dependent Repression of ERRγ Reprograms Metabolism in Prostate Cancer. Cancer Res. 2017;77(2):378–89.
Bai F, He Z, Zhou H, Gan W. Kinesin family member 2A links with advanced tumor stage, reduced chemosensitivity and worse prognosis in gastric cancer. J Clin Lab Anal. 2022;36(5): e24313.
Fan M, Yang K, Wang X, Chen L, Gill PS, Ha T, Liu L, Lewis NH, Williams DL, Li C. Lactate promotes endothelial-to-mesenchymal transition via Snail1 lactylation after myocardial infarction. Sci Adv. 2023;9(5):3.
Reese M, Dhayat SA. Small extracellular vesicle non-coding RNAs in pancreatic cancer: molecular mechanisms and clinical implications. J Hematol Oncol. 2021;14(1):021–01149.
Hou Y, Zi J, Ge Z. High Expression of RhoF Predicts Worse Overall Survival: A Potential Therapeutic Target for non-M3 Acute Myeloid Leukemia. J Cancer. 2021;12(18):5530–42.
Shaverdashvili K, Padlo J, Weinblatt D, Jia Y, Jiang W, Rao D, Laczkó D, Whelan KA, Lynch JP, Muir AB, et al. KLF4 activates NFκB signaling and esophageal epithelial inflammation via the Rho-related GTP-binding protein RHOF. PLoS One. 2019;14(4):e0215746.
Li S, Liu Y, Bai Y, Chen M, Cheng D, Wu M, Xia J. Ras Homolog Family Member F, Filopodia Associated Promotes Hepatocellular Carcinoma Metastasis by Altering the Metabolic Status of Cancer Cells Through RAB3D. Hepatology. 2021;73(6):2361–79.
Recouvreux MV, Moldenhauer MR, Galenkamp KMO, Jung M, James B, Zhang Y, Lowy A, Bagchi A, Commisso C. Glutamine depletion regulates Slug to promote EMT and metastasis in pancreatic cancer. J Exp Med. 2020;217(9):20200388.
Liu M, Zhang Y, Yang J, Zhan H, Zhou Z, Jiang Y, Shi X, Fan X, Zhang J, Luo W, et al. Zinc-Dependent Regulation of ZEB1 and YAP1 Coactivation Promotes Epithelial-Mesenchymal Transition Plasticity and Metastasis in Pancreatic Cancer. Gastroenterology. 2021;160(5):1771–83.
Serrano-Gomez SJ, Maziveyi M, Alahari SK. Regulation of epithelial-mesenchymal transition through epigenetic and post-translational modifications. Mol Cancer. 2016;15(18):016–0502.
Loh CY, Chai JY, Tang TF, Wong WF, Sethi G, Shanmugam MK, Chong PP, Looi CY. The E-Cadherin and N-Cadherin Switch in Epithelial-to-Mesenchymal Transition: Signaling, Therapeutic Implications, and Challenges. Cells. 2019;8(10):1118.
Satelli A, Li S. Vimentin in cancer and its potential as a molecular target for cancer therapy. Cell Mol Life Sci. 2011;68(18):3033–46.
Liu Y, Hua F, Zhan Y, Yang Y, Xie J, Cheng Y, Li F. Carcinoma associated fibroblasts small extracellular vesicles with low miR-7641 promotes breast cancer stemness and glycolysis by HIF-1α. Cell Death Discov. 2021;7(1):021–00524.
Pucino V, Cucchi D, Mauro C. Lactate transporters as therapeutic targets in cancer and inflammatory diseases. Expert Opin Ther Targets. 2018;22(9):735–43.
Hirschhaeuser F, Sattler UG, Mueller-Klieser W. Lactate: a metabolic key player in cancer. Cancer Res. 2011;71(22):6921–5.
Amendola CR, Mahaffey JP, Parker SJ, Ahearn IM, Chen WC, Zhou M, Court H, Shi J, Mendoza SL, Morten MJ, et al. KRAS4A directly regulates hexokinase 1. Nature. 2019;576(7787):482–6.
Tan VP, Miyamoto S. HK2/hexokinase-II integrates glycolysis and autophagy to confer cellular protection. Autophagy. 2015;11(6):963–4.
Shi T, Ma Y, Cao L, Zhan S, Xu Y, Fu F, Liu C, Zhang G, Wang Z, Wang R, et al. B7–H3 promotes aerobic glycolysis and chemoresistance in colorectal cancer cells by regulating HK2. Cell Death Dis. 2019;10(4):019–1549.
Zhang J, Chen G, Gao Y, Liang H. HOTAIR/miR-125 axis-mediated Hexokinase 2 expression promotes chemoresistance in human glioblastoma. J Cell Mol Med. 2020;24(10):5707–17.
Gu Z, Xia J, Xu H, Frech I, Tricot G, Zhan F. NEK2 Promotes Aerobic Glycolysis in Multiple Myeloma Through Regulating Splicing of Pyruvate Kinase. J Hematol Oncol. 2017;10(1):017–0392.
Sharma D, Singh M, Rani R. Role of LDH in tumor glycolysis: Regulation of LDHA by small molecules for cancer therapeutics. Semin Cancer Biol. 2022;87:184–95.
Brand A, Singer K, Koehl GE, Kolitzus M, Schoenhammer G, Thiel A, Matos C, Bruss C, Klobuch S, Peter K, et al. LDHA-Associated Lactic Acid Production Blunts Tumor Immunosurveillance by T and NK Cells. Cell Metab. 2016;24(5):657–71.
Wahlström T, Henriksson MA. Impact of MYC in regulation of tumor cell metabolism. Biochim Biophys Acta. 2015;5:563–9.
Acknowledgements
Not applicable.
Funding
This study was supported by the Natural Science Foundation of Shandong Province (ZR2020MH231).
Author information
Authors and Affiliations
Contributions
R Z designed the study; R Z, YM Y, H L, JW X, SH C, D W, L W and F L performed the research and analysed data; L W and F L wrote the paper. All authors have read and approved the manuscript.
Corresponding authors
Ethics declarations
Ethics approval and consent to participate
The experimental protocol of our study was performed in accordance with the Guide for the Care and Use of Laboratory Animals and approved by Qi Lu Hospital, Cheeloo College of Medicine, Shandong University. The protocol of this research has been approved by the Ethics Committee of Qi Lu Hospital, Cheeloo College of Medicine, Shandong University. All patients have signed written informed consent.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
About this article
Cite this article
Zhao, R., Yi, Y., Liu, H. et al. RHOF promotes Snail1 lactylation by enhancing PKM2-mediated glycolysis to induce pancreatic cancer cell endothelial–mesenchymal transition. Cancer Metab 12, 32 (2024). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s40170-024-00362-2
Received:
Accepted:
Published:
DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s40170-024-00362-2